Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG-hChR2(H134R)-EYFP
(Plasmid #114367)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114367 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4815
  • Total vector size (bp) 6477
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hChR2(H134R)
  • Alt name
    Channelrhodopsin 2
  • Alt name
    ChR2
  • Alt name
    ChR2(H134R)
  • Insert Size (bp)
    1662
  • Mutation
    the Histidine at amino acid position 134 was changed to Arginine in ChR2
  • Promoter pCAG
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI, KpnI, NheI, BmtI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG (pCAG-F)
  • 3′ sequencing primer GTCTTGTAGTTGCCGTCGTC (EXFP-R)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pCAG backbone vector from pCAG-EGFP (Addgene #11150); hChR2*H134R)-EYFP from pAAV-EF1α-DIO-hChR2(H134R)-EYFP (Addgene #20298).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-hChR2(H134R)-EYFP was a gift from Mingshan Xue (Addgene plasmid # 114367 ; http://n2t.net/addgene:114367 ; RRID:Addgene_114367)
  • For your References section:

    Targeting light-gated chloride channels to neuronal somatodendritic domain reduces their excitatory effect in the axon. Messier JE, Chen H, Cai ZL, Xue M. Elife. 2018 Aug 9;7. pii: 38506. doi: 10.7554/eLife.38506. 10.7554/eLife.38506 PubMed 30091701