pStA0::ECK120033737
(Plasmid
#114341)
-
PurposeTerminator ECK120033737 in pStA0
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGT400
- Backbone size w/o insert (bp) 2206
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTerminator ECK120033737
-
SpeciesSynthetic
-
Insert Size (bp)60
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer OligoGT234 GGGGAAACGCCTGGTATCT
- 3′ sequencing primer OligoGT235 AGCAAAAACAGGAAGGCAAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Accession Number MG649448, Alternative ID = pGT339 . Please visit https://www.biorxiv.org/content/early/2018/07/04/361626 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pStA0::ECK120033737 was a gift from John Heap (Addgene plasmid # 114341 ; http://n2t.net/addgene:114341 ; RRID:Addgene_114341) -
For your References section:
Start-Stop Assembly: a functionally scarless DNA assembly system optimized for metabolic engineering. Taylor GM, Mordaka PM, Heap JT. Nucleic Acids Res. 2018 Nov 20. pii: 5193345. doi: 10.1093/nar/gky1182. 10.1093/nar/gky1182 PubMed 30462270