Skip to main content
Addgene

pSKB3.TM1468
(Plasmid #11431)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11431 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSKB3
  • Backbone size w/o insert (bp) 5386
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    fatty acid binding protein
  • Species
    T. maritima
  • Insert Size (bp)
    864
  • GenBank ID
    AAD36536 NP_229268 TM1468

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the plasmid pSKB3.TM1468 contains a Kanamycin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSKB3.TM1468 was a gift from Sung-Hou Kim (Addgene plasmid # 11431 ; http://n2t.net/addgene:11431 ; RRID:Addgene_11431)

  • For your References section:

    Crystal structure of a hypothetical protein, TM841 of Thermotoga maritima, reveals its function as a fatty acid-binding protein. Schulze-Gahmen U, Pelaschier J, Yokota H, Kim R, Kim SH. Proteins. 2003 Mar 1. 50(4):526-30. 10.1002/prot.10305 PubMed 12577257
Related items: