lenti U6-sgRNA/EF1a-mCherry
(Plasmid #114199)

• Purpose: Lentivirus compatible SpCas9/dCas9 sgRNA scaffold driven by the U6 promoter and mCherry driven by the EF1a promoter
• Depositing Lab: Jeremy Day
• Publication: Savell et al eNeuro. 2019 Mar 7;6(1). pii: eN-MNT-0495-18. doi: 10.1523/ENEURO.0495-18.2019. eCollection 2019 Jan-Feb.

Backbone

• Vector backbone: lentiCRISPR v2
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sgRNA scaffold
• Promoter: U6
• Tag / Fusion Protein:
  • mCherry

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTTCTTGGGTAGTTTGCAGTTTT

Resource Information

• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene #47108 adapted into lentivirus backbone and insertion of EF1a mCherry . Please visit https://www.biorxiv.org/content/early/2018/07/17/371500 for bioRxiv preprint.