lenti CAG-FLAG-dCas9-VPR
(Plasmid #114197)

• Purpose: Lentivirus compatible dCas9-VPR construct driven by the CAG promoter
• Depositing Lab: Jeremy Day
• Publication: Savell et al eNeuro. 2019 Mar 7;6(1). pii: eN-MNT-0495-18. doi: 10.1523/ENEURO.0495-18.2019. eCollection 2019 Jan-Feb.

Backbone

• Vector backbone: lentiCRISPR v2
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: dCas9-VPR
• Species: Synthetic
• Insert Size (bp): 5865
• Promoter: CAG
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTTATTACAGGGACAGCAGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene #63798 into lentivirus backbone and addition of N-term FLAG tag.

Please note: Addgene NGS was unable to fully resolve the GC rich sequence within the Chicken beta-actin promoter. Please refer to the depositor sequence for that region. Please visit https://www.biorxiv.org/content/early/2018/07/17/371500 for bioRxiv preprint.