pcDNA3.1-Beta2-PAmcherry1
(Plasmid
#114190)
-
Purposestudying clustering of Beta2 receptors by superresolution microscopy (PALM)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5424
-
Modifications to backboneβ2-pamCherry1 was generated by replacing mEos2 in the β2-mEos2 construct by pamCherry1 using the XhoI and ApaI restriction sites. The primers ATCCGC- GAACTCGAGATGGTCAGCAAGGGCGAG (sense) and AGGTCCGAGGGCCCCTTACTTGTACAGCTCGTC (antisense) were used to generate a XhoI and ApaI sites in the pamCherry1 insert by PCR.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAdrenergic receptor beta 2
-
Alt nameBeta2
-
Alt nameADRB2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1326
-
Entrez GeneADRB2 (a.k.a. ADRB2R, ADRBR, ARB2, B2AR, BAR, BETA2AR)
- Promoter SV40
-
Tags
/ Fusion Proteins
- FLAG (N terminal on backbone)
- 3HA (N terminal on insert)
- PAmcherry1 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Beta2-PAmcherry1 was a gift from Aleksandra Radenovic (Addgene plasmid # 114190 ; http://n2t.net/addgene:114190 ; RRID:Addgene_114190)