pcDNA3.1-Beta2-PAmcherry1
(Plasmid #114190)

• Purpose: studying clustering of Beta2 receptors by superresolution microscopy (PALM)
• Depositing Lab: Aleksandra Radenovic
• Publication: Radenovic Lab plasmids (unpublished)

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5424
• Modifications to backbone: β2-pamCherry1 was generated by replacing mEos2 in the β2-mEos2 construct by pamCherry1 using the XhoI and ApaI restriction sites. The primers ATCCGC- GAACTCGAGATGGTCAGCAAGGGCGAG (sense) and AGGTCCGAGGGCCCCTTACTTGTACAGCTCGTC (antisense) were used to generate a XhoI and ApaI sites in the pamCherry1 insert by PCR.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Adrenergic receptor beta 2
• Alt name: Beta2
• Alt name: ADRB2
• Species: H. sapiens (human)
• Insert Size (bp): 1326
• Entrez Gene: ADRB2 (a.k.a. ADRB2R, ADRBR, ARB2, B2AR, BAR, BETA2AR)
• Promoter: SV40
• Tags / Fusion Proteins:
  • FLAG (N terminal on backbone)
  • 3HA (N terminal on insert)
  • PAmcherry1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: ApaI (not destroyed)
• 5′ sequencing primer: unknown

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry