Skip to main content
Addgene

pET21a.MJ0307
(Plasmid #11415)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11415 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET21a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5443
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    disulfide oxidoreductase
  • Species
    M. jannaschii
  • Insert Size (bp)
    255
  • GenBank ID
    AAB98293 NP_247280 MJ0307

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the plasmid pET21a.MJ0307 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET21a.MJ0307 was a gift from Sung-Hou Kim (Addgene plasmid # 11415 ; http://n2t.net/addgene:11415 ; RRID:Addgene_11415)

  • For your References section:

    Solution nuclear magnetic resonance structure of a protein disulfide oxidoreductase from Methanococcus jannaschii. Cave JW, Cho HS, Batchelder AM, Yokota H, Kim R, Wemmer DE. Protein Sci. 2001 Feb . 10(2):384-96. 10.1110/ps.35101 PubMed 11266624
Related items:
Commonly requested with: