pGLUE-SHLD2
(Plasmid #114118)

• Purpose: Expresses N-terminally tagged Streptag-HA-CBP-SHLD2 in mammalian cells
• Depositing Lab: Daniel Durocher
• Publication: Noordermeer et al Nature. 2018 Aug;560(7716):117-121. doi: 10.1038/s41586-018-0340-7. Epub 2018 Jul 18.

Backbone

• Vector backbone: V51 pIRESpuro-GLUE (pGLUE)
• Backbone size w/o insert (bp): 5468
• Total vector size (bp): 8177
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SHLD2
• Alt name: FAM35A
• Alt name: RINN2
• Species: H. sapiens (human)
• Insert Size (bp): 2709
• Entrez Gene: SHLD2 (a.k.a. FAM35A, FAM35A1, RINN2, bA163M19.1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Streptavidin-binding tag (Streptag) (N terminal on backbone)
  • HA tag (N terminal on backbone)
  • calmodulin-binding peptide (CBP) (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CMV Forward
• 3′ sequencing primer: pGLUE-seqR (ggacgcggccaccctcaaagg)

Resource Information

• Supplemental Documents:
  • pGLUE-SHLD2 for Addgene.gbk
• A portion of this plasmid was derived from a plasmid made by: ORFeome

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

The SHLD2 short isoform cDNA was obtained from the ORFeome collection. The complete coding sequence of the long isoform of SHLD2 was generated by combining a synthesized fragment corresponding to the long isoform C-terminus using an internal KpnI site.