pGLUE-SHLD2
(Plasmid
#114118)
-
PurposeExpresses N-terminally tagged Streptag-HA-CBP-SHLD2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114118 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backboneV51 pIRESpuro-GLUE (pGLUE)
- Backbone size w/o insert (bp) 5468
- Total vector size (bp) 8177
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSHLD2
-
Alt nameFAM35A
-
Alt nameRINN2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2709
-
Entrez GeneSHLD2 (a.k.a. FAM35A, FAM35A1, RINN2, bA163M19.1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Streptavidin-binding tag (Streptag) (N terminal on backbone)
- HA tag (N terminal on backbone)
- calmodulin-binding peptide (CBP) (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer pGLUE-seqR (ggacgcggccaccctcaaagg) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byORFeome
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The SHLD2 short isoform cDNA was obtained from the ORFeome collection. The complete coding sequence of the long isoform of SHLD2 was generated by combining a synthesized fragment corresponding to the long isoform C-terminus using an internal KpnI site.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGLUE-SHLD2 was a gift from Daniel Durocher (Addgene plasmid # 114118 ; http://n2t.net/addgene:114118 ; RRID:Addgene_114118) -
For your References section:
The shieldin complex mediates 53BP1-dependent DNA repair. Noordermeer SM, Adam S, Setiaputra D, Barazas M, Pettitt SJ, Ling AK, Olivieri M, Alvarez-Quilon A, Moatti N, Zimmermann M, Annunziato S, Krastev DB, Song F, Brandsma I, Frankum J, Brough R, Sherker A, Landry S, Szilard RK, Munro MM, McEwan A, Goullet de Rugy T, Lin ZY, Hart T, Moffat J, Gingras AC, Martin A, van Attikum H, Jonkers J, Lord CJ, Rottenberg S, Durocher D. Nature. 2018 Aug;560(7716):117-121. doi: 10.1038/s41586-018-0340-7. Epub 2018 Jul 18. 10.1038/s41586-018-0340-7 PubMed 30022168