pAAV-hSyn-LMO4 (GLucM23-VChR1-EYFP)
(Plasmid
#114101)
-
Purposefusion protein of Gaussia luciferase variant M23, Volvox channelrhodopsin-1, and enhanced yellow fluorescent protein for bioluminescent optogenetics
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4593
- Total vector size (bp) 6901
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameGaussia luciferase, M23
-
Alt nameGLucM23
- Promoter hSyn
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer ACTGAAGGCGCGCTGACGTCACT
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameVolvox Channelrhodopsin 1
-
Alt nameVChR1
Gene/Insert 3
-
Gene/Insert nameEnhanced Yellow Fluorescent Protein
-
Alt nameEYFP
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-LMO4 (GLucM23-VChR1-EYFP) was a gift from Ute Hochgeschwender (Addgene plasmid # 114101 ; http://n2t.net/addgene:114101 ; RRID:Addgene_114101) -
For your References section:
Novel luciferase-opsin combinations for improved luminopsins. Park SY, Song SH, Palmateer B, Pal A, Petersen ED, Shall GP, Welchko RM, Ibata K, Miyawaki A, Augustine GJ, Hochgeschwender U. J Neurosci Res. 2017 Sep 1. doi: 10.1002/jnr.24152. 10.1002/jnr.24152 PubMed 28862809