pAAV-hSyn-iLMO (slGLuc-Mac-EYFP)
(Plasmid #114100)

• Purpose: fusion protein of Gaussia luciferase variant superluminescent, Leptosphaeria maculans opsin, and enhanced yellow fluorescent protein for bioluminescent optogenetics
• Depositing Lab: Ute Hochgeschwender
• Publication: Berglund et al Proc Natl Acad Sci U S A. 2016 Jan 19;113(3):E358-67. doi: 10.1073/pnas.1510899113. Epub 2016 Jan 5.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4563
• Total vector size (bp): 7010
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Gaussia luciferase, superluminescent
• Alt name: slGLuc
• Promoter: hSyn

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ACTGAAGGCGCGCTGACGTCACT
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Gene/Insert 2

• Gene/Insert name: Leptosphaeria maculans
• Alt name: Mac

Gene/Insert 3

• Gene/Insert name: Enhanced Yellow Fluorescent Protein
• Alt name: EYFP

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry