pAAV-hSyn-LMO3 (sbGLuc-VChR1-EYFP)
(Plasmid #114099)

• Purpose: fusion protein of Gaussia luciferase variant slow burn, Volvox channelrhodopsin-1, and enhanced yellow fluorescent protein for bioluminescent optogenetics
• Depositing Lab: Ute Hochgeschwender
• Publication: Berglund et al Proc Natl Acad Sci U S A. 2016 Jan 19;113(3):E358-67. doi: 10.1073/pnas.1510899113. Epub 2016 Jan 5.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4604
• Total vector size (bp): 6952
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Gaussia luciferase, slow burn
• Alt name: sbGLuc
• Promoter: hSyn

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: ACTGAAGGCGCGCTGACGTCACT
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Gene/Insert 2

• Gene/Insert name: Volvox Channelrhodopsin 1
• Alt name: VChR1

Gene/Insert 3

• Gene/Insert name: Enhanced Yellow Fluorescent Protein
• Alt name: EYFP

Resource Information

• Supplemental Documents:
  • pAAV hSyn LMO3.gbk
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry