YFP-Rac1(L61)
(Plasmid #11401)

• Depositing Lab: Joel Swanson
• Publication: Hoppe et al Mol Biol Cell 2004 Aug;15(8):3509-19. Epub 2004 May 28.

Backbone

• Vector backbone: pEYFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ras-related C3 botulinum toxin substrate 1
• Alt name: Rac1(L61)
• Alt name: YFP
• Species: H. sapiens (human)
• Insert Size (bp): 580
• Mutation: Obtained with Glutamine 61 mutated to Leucine.
• GenBank ID: AF498964
• Entrez Gene: RAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)
• Tag / Fusion Protein:
  • YFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CCTGAGCAAAGACCCCAACGAGAA
• 3′ sequencing primer: CAGGGGGAGGTGTGGGAGGTTT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Human Rac1(Q61L) cDNA was a gift from Klaus Hahn.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Expresses Rac1(61L) with an N-terminal YFP marker. YFP is the monomeric (A207K) version of Citrine, a pH-insensitive YFP.