pHAGE-EF1a-MICB*005-IRES-ZsGreen
(Plasmid
#114008)
-
PurposeInduces expression of human MICB allele 005 cDNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114008 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHAGE-CMV-fullEF1a-IRES-ZsGreen
-
Backbone manufacturerHarvard Medical School
- Backbone size w/o insert (bp) 8346
- Total vector size (bp) 9372
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZsGreen
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMICB*005
-
Alt nameMICB
-
Alt nameC1601
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1026
-
Entrez GeneMICB (a.k.a. PERB11.2)
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer AAAAAAGCGG CCGCATGGGGCTGG GCCGGGTCC
- 3′ sequencing primer AAAAAAGGAT CCCTAGGCGCCCTCAGTGGAACCA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-EF1a-MICB*005-IRES-ZsGreen was a gift from Kai Wucherpfennig (Addgene plasmid # 114008 ; http://n2t.net/addgene:114008 ; RRID:Addgene_114008) -
For your References section:
Antibody-mediated inhibition of MICA and MICB shedding promotes NK cell-driven tumor immunity. Ferrari de Andrade L, Tay RE, Pan D, Luoma AM, Ito Y, Badrinath S, Tsoucas D, Franz B, May KF Jr, Harvey CJ, Kobold S, Pyrdol JW, Yoon C, Yuan GC, Hodi FS, Dranoff G, Wucherpfennig KW. Science. 2018 Mar 30;359(6383):1537-1542. doi: 10.1126/science.aao0505. 10.1126/science.aao0505 PubMed 29599246