-
Purposeexpress sgRNA, p15A, CRM
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepsgRNA
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegRNA
-
gRNA/shRNA sequenceTGAGACCAGTCTAGGTCTCG
-
SpeciesE. coli
- Promoter BBa_J23119
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GCTAGGAGGTGACTGAAGTAT
- 3′ sequencing primer AGCAGTGTGACCGTGTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psgRNAc was a gift from David Bikard (Addgene plasmid # 114006 ; http://n2t.net/addgene:114006 ; RRID:Addgene_114006) -
For your References section:
A CRISPRi screen in E. coli reveals sequence-specific toxicity of dCas9. Cui L, Vigouroux A, Rousset F, Varet H, Khanna V, Bikard D. Nat Commun. 2018 May 15;9(1):1912. doi: 10.1038/s41467-018-04209-5. 10.1038/s41467-018-04209-5 [pii] PubMed 29765036