sg1
(Plasmid
#113966)
-
PurposeSingle short guide RNA targeting GTATAGCATACATTATACG
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113966 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 2600
- Total vector size (bp) 430
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesg1
-
gRNA/shRNA sequenceCGTATAATGTATGCTATAC
-
SpeciesH. sapiens (human), M. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer GGTTATTGTCTCATGAGCGG
- 3′ sequencing primer CCTGTGTGAAATTGTTATCCGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sg1 was a gift from Jordan Green (Addgene plasmid # 113966 ; http://n2t.net/addgene:113966 ; RRID:Addgene_113966) -
For your References section:
Poly(Beta-Amino Ester) Nanoparticles Enable Nonviral Delivery of CRISPR-Cas9 Plasmids for Gene Knockout and Gene Deletion. Rui Y, Varanasi M, Mendes S, Yamagata HM, Wilson DR, Green JJ. Mol Ther Nucleic Acids. 2020 Apr 21;20:661-672. doi: 10.1016/j.omtn.2020.04.005. 10.1016/j.omtn.2020.04.005 PubMed 32380416