Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PB-iRFP-STOP-ReNL
(Plasmid #113965)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113965 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBR322
  • Modifications to backbone
    Piggybac inserts
  • Vector type
    Mammalian Expression ; Piggybac transposon

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    iRFP670
  • Species
    H. sapiens (human), M. musculus (mouse), Synthetic
  • Insert Size (bp)
    950
  • GenBank ID
    KC991142
  • Promoter EF1A

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTTCCTTGACCCTGGAAGG
  • 3′ sequencing primer ATTAAGGGATCTGTAGGGCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ReNL
  • Alt name
    Red enhanced nanolantern
  • Species
    H. sapiens (human), M. musculus (mouse), Synthetic
  • Insert Size (bp)
    1908
  • GenBank ID
    LC128718
  • Promoter CMV - SV40-PolyA - SV40-PolyA

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AATTCATGGTGAGCAAGGGC
  • 3′ sequencing primer CCTGTGTGAAATTGTTATCCGCT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pNLS-iRFP670 was a gift from Vladislav Verkhusha (Addgene plasmid # 45466) ReNL/pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 85203)
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Piggybac transposon plasmid for stable expression of iRFP670 (far red fluorescent protein) for FACS sorting with CRISPR/Cas9 mediated fluorescence/luminescence reporter of ReNL following elimination of SV40 polyA sequences by gene editing deletion.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-iRFP-STOP-ReNL was a gift from Jordan Green (Addgene plasmid # 113965 ; http://n2t.net/addgene:113965 ; RRID:Addgene_113965)
  • For your References section:

    Carboxylated branched poly(beta-amino ester) nanoparticles enable robust cytosolic protein delivery and CRISPR-Cas9 gene editing. Rui Y, Wilson DR, Choi J, Varanasi M, Sanders K, Karlsson J, Lim M, Green JJ. Sci Adv. 2019 Dec 6;5(12):eaay3255. doi: 10.1126/sciadv.aay3255. eCollection 2019 Dec. 10.1126/sciadv.aay3255 PubMed 31840076