-
PurposeMammalian constitutive expression of HA-tagged Tetracyclin repressor protein and Myc-tagged blasticidin deaminase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113899 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR-CMV
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTetR-HA-NLS-P2A-BSD-Myc
-
Insert Size (bp)1203
- Promoter CMV-MIE
-
Tag
/ Fusion Protein
- HA-Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BsiWI (not destroyed)
- 5′ sequencing primer CGTCGTCGTGCTCGTTTAGTG
- 3′ sequencing primer CATTAAAGCAGCGTATCCACATAGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-CMV_TetR-HA-NLS-P2A-BSD-Myc was a gift from A. Radu Aricescu (Addgene plasmid # 113899 ; http://n2t.net/addgene:113899 ; RRID:Addgene_113899) -
For your References section:
Lentiviral transduction of mammalian cells for fast, scalable and high-level production of soluble and membrane proteins. Elegheert J, Behiels E, Bishop B, Scott S, Woolley RE, Griffiths SC, Byrne EFX, Chang VT, Stuart DI, Jones EY, Siebold C, Aricescu AR. Nat Protoc. 2018 Nov 19. pii: 10.1038/s41596-018-0075-9. doi: 10.1038/s41596-018-0075-9. 10.1038/s41596-018-0075-9 PubMed 30455477