pYFP-NGAT(A193T,N194Y)
(Plasmid #11388)

• Depositing Lab: Joel Swanson
• Publication: Beemiller et al PLoS Biol. 2006 May 9. 4(6):e162.

Backbone

• Vector backbone: pEYFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: golgi associated, gamma adaptin ear containing, ARF binding protein 1
• Alt name: GGA1
• Alt name: NGAT
• Alt name: hook
• Species: H. sapiens (human)
• Insert Size (bp): 141
• Mutation: Changed Alanine 193 to Threonine, and Asparagine 194 to Tyrosine
• GenBank ID: NM_013365
• Entrez Gene: GGA1
• Tag / Fusion Protein:
  • YFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CCTGAGCAAAGACCCCAACGAGAA
• 3′ sequencing primer: CAGGGGGAGGTGTGGGAGGTTT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: hGGA1 cDNA was a gift of Juan Bonifacino. The N-terminal end of the GAT domain, corresponding to amino acids 165-210 and termed NGAT, were amplified and inserted in pEYFP-C1. This was then mutagenized to create the A193T, N194Y mutation.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Encodes a YFP fusion to the N-terminus of the mutated GGA1 NGAT domain. YFP is the monomeric (A207K) version of Citrine, a pH-insensitive YFP variant.