Skip to main content
Addgene

pUDR295
(Plasmid #113874)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113874 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pROS16 (#107930)
  • Backbone manufacturer
    Mans et al FEMS Yeast Res. 2015 Mar;15(2). pii: fov004
  • Backbone size w/o insert (bp) 5465
  • Total vector size (bp) 5463
  • Modifications to backbone
    replacement of double CAN1 sgRNA target with GAL2 and HXT1, 3-7
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA2 GAL2 sgRNA1-HXT4-1-5;HXT3-6-7
  • gRNA/shRNA sequence
    TTATTTATGTGAGGTGAATA / TAGTAGAAGAAATAGTTATC/
  • Species
    S. cerevisiae (budding yeast)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone of the pMEL and pROS series was derived from p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene # 43803).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUDR295 was a gift from Jean-Marc Daran & Jack Pronk (Addgene plasmid # 113874 ; http://n2t.net/addgene:113874 ; RRID:Addgene_113874)

  • For your References section:

    A toolkit for rapid CRISPR-SpCas9 assisted construction of hexose-transport-deficient Saccharomyces cerevisiae strains. Wijsman M, Swiat MA, Marques WL, Hettinga JK, van den Broek M, Torre Cortes P, Mans R, Pronk JT, Daran JM, Daran-Lapujade P. FEMS Yeast Res. 2019 Jan 1;19(1). pii: 5114578. doi: 10.1093/femsyr/foy107. 10.1093/femsyr/foy107 PubMed 30285096
Related items:
Commonly requested with: