Skip to main content
Addgene

pUDR220
(Plasmid #113873)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113873 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pROS14 (#107928)
  • Backbone manufacturer
    Mans et al FEMS Yeast Res. 2015 Mar;15(2). pii: fov004
  • Backbone size w/o insert (bp) 6632
  • Total vector size (bp) 6632
  • Modifications to backbone
    replacement of double CAN1 sgRNA target with HXT10 and HXT9,11,12 sgRNA targets
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA8-HXT10 sgRNA7-HXT9-11-12
  • gRNA/shRNA sequence
    TTACTATCAACAATAACTAA /
  • Species
    S. cerevisiae (budding yeast)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone of the pMEL and pROS series was derived from p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene # 43803).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUDR220 was a gift from Jean-Marc Daran & Jack Pronk (Addgene plasmid # 113873 ; http://n2t.net/addgene:113873 ; RRID:Addgene_113873)

  • For your References section:

    A toolkit for rapid CRISPR-SpCas9 assisted construction of hexose-transport-deficient Saccharomyces cerevisiae strains. Wijsman M, Swiat MA, Marques WL, Hettinga JK, van den Broek M, Torre Cortes P, Mans R, Pronk JT, Daran JM, Daran-Lapujade P. FEMS Yeast Res. 2019 Jan 1;19(1). pii: 5114578. doi: 10.1093/femsyr/foy107. 10.1093/femsyr/foy107 PubMed 30285096
Related items:
Commonly requested with: