-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11387 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepECFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4733
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameADP Ribosylation Factor 6
-
Alt nameARF6(Q67L)
-
Alt nameCFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)527
-
GenBank IDNP_001654
-
Entrez GeneARF6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GGTGGGAGGTCTATATAAGCAGAGCTGGTT
- 3′ sequencing primer CCCCGGTGAACAGCTCCTCGCCCTTGCTCA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhARF6 was obtained from the UMR cDNA Resource center (www.cDNA.org) and mutagenized using site-directed mutagenesis.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Encodes a CFP fusion to the C-terminus of constitutively-active ARF6. CFP is the monomeric (A207K) version of ECFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pARF6(Q67L)-CFP was a gift from Joel Swanson (Addgene plasmid # 11387 ; http://n2t.net/addgene:11387 ; RRID:Addgene_11387) -
For your References section:
A Phosphatidylinositol-3-Kinase-Dependent Signal Transition Regulates ARF1 and ARF6 during Fcgamma Receptor-Mediated Phagocytosis. Beemiller P, Hoppe AD, Swanson JA. PLoS Biol. 2006 May 9. 4(6):e162. 10.1371/journal.pbio.0040162 PubMed 16669702