pMuLE_EXPR_CMV-eGFP_TOP-iRFP_PTCH1-mTurquoise2_CBF-tdTomato
(Plasmid #113865)

• Purpose: Triple pathway reporter, 3P-Fluor; wnt-iRFP, hedgehog-mTurquoise2, notch-tdTomato; plus CMV-eGFP. Gateway expression vector for lentivirus generation.
• Depositing Lab: Manfred Ogris
• Publication: Maier et al PLoS One. 2019 Dec 20;14(12):e0226570. doi: 10.1371/journal.pone.0226570. eCollection 2019.

Backbone

• Vector backbone: pMuLE Lenti Dest Neo
• Backbone size w/o insert (bp): 9237
• Total vector size (bp): 14704
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Neomycin (select with G418) ; eGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CMV-eGFP
• Insert Size (bp): 1475

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: AGGCAGGGATATTCACCATT

Gene/Insert 2

• Gene/Insert name: TOP-iRFP
• Alt name: M50 Super 8x TOPFlash, promoter only
• Alt name: iRFP713
• Insert Size (bp): 1315

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CAACAGCCACAACGTCTA

Gene/Insert 3

• Gene/Insert name: PTCH1-mTurquoise2
• Alt name: hPtch1 prom wt
• Insert Size (bp): 2295

Cloning Information for Gene/Insert 3

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GAGCTAGTCGCCCAGGTTCT

Gene/Insert 4

• Gene/Insert name: CBF-tdTomato
• Alt name: CBFRE
• Insert Size (bp): 1961

Cloning Information for Gene/Insert 4

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CCAGAAGTAGTGAGGAGGCTTT

Resource Information

• Supplemental Documents:
  • pMuLE_EXPR_CMV-eGFP_TOP-iRFP_PTCH1-mTurquoise2_CBF-tdTomato.gb
• A portion of this plasmid was derived from a plasmid made by: Backbone is included in the MuLE kit, which was a gift from Ian Frew (Addgene kit #1000000060).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry