pE2F3.3.1-gDNA
(Plasmid
#113776)
-
PurposeCRISPR plasmid for expression of Cas9 nickase (D10A) and gRNA targeting human transcription factor E2F3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113776 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX462
-
Backbone manufacturerZhang lab (Addgene plasmid ID: 62987)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE2F3
-
gRNA/shRNA sequenceTGATGCCTTCCTCCTCCCCG AGG
-
SpeciesH. sapiens (human)
-
Entrez GeneE2F3 (a.k.a. E2F-3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3') (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA sequence listed includes 20 nucleotide target sequence, followed by the uncloned PAM sequence. The PAM sequence is not present in the plasmid. This is a nickase guide and must be used with the additional nickase plasmid pE2F3.3.2-gDNA and donor plasmid pE2F3-donor.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pE2F3.3.1-gDNA was a gift from Kevin White (Addgene plasmid # 113776 ; http://n2t.net/addgene:113776 ; RRID:Addgene_113776)