Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pVP91A-pcaHG
(Plasmid #113766)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113766 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pVP91A vector
  • Backbone manufacturer
    DNASU plasmid repository, Arizona State University Biodesign Institute
  • Backbone size w/o insert (bp) 4010
  • Total vector size (bp) 5382
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use E. coli Bl21 for protein expression
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    β subunit of Protocatechuate 3,4- Dioxygenase
  • Species
    P. putida
  • Insert Size (bp)
    720
  • Promoter T5 promoter
  • Tag / Fusion Protein
    • Met-6xHis (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer CACACAGAATTCATTAAAGAGG
  • 3′ sequencing primer GTCGACTCTAGAGGATCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    α subunit of Protocatechuate 3,4- Dioxygenase
  • Species
    P. putida
  • Insert Size (bp)
    606
  • Promoter T5 promoter

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer CACACAGAATTCATTAAAGAGG
  • 3′ sequencing primer GTCGACTCTAGAGGATCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    John D. Lipscomb, Department of Biochemistry Molecular Biology and Biophysics and Center for Metals in Biocatalysis, University of Minnesota, Minneapolis, MN 55455 [email protected].
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please ensure that the chosen expression cell line expresses the T5 RNA polymerase.

Senavirathne, G., et al., Expression and purification of nuclease-free protocatechuate 3,4-dioxygenase for prolonged single-molecule fluorescence imaging. Anal Biochem, 2018. 556: p. 78-84.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVP91A-pcaHG was a gift from John Lipscomb (Addgene plasmid # 113766 ; http://n2t.net/addgene:113766 ; RRID:Addgene_113766)
  • For your References section:

    Crystal structures of alkylperoxo and anhydride intermediates in an intradiol ring-cleaving dioxygenase. Knoot CJ, Purpero VM, Lipscomb JD. Proc Natl Acad Sci U S A. 2015 Jan 13;112(2):388-93. doi: 10.1073/pnas.1419118112. Epub 2014 Dec 29. 10.1073/pnas.1419118112 PubMed 25548185