aav-SYN-FLEX-tdNfsB(F124W)-mCherry (eNTR)
(Plasmid
#113763)
-
PurposeAAV-mediated conditional expression of bacterial tdNfsB-mCherry (eNTR) under the SYN promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV2
-
Backbone manufacturerScott Sternson
- Total vector size (bp) 7296
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStabl2 or Stabl3, 30C or 37C
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametdNfsB(F124W)-mCherry
-
Alt namenfsb, eNTR
-
SpeciesE. coli
-
Insert Size (bp)2115
-
MutationF124W
- Promoter Synapsin
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer TTAAAGCAGCGTATCCACAT
- 3′ sequencing primer CGGTGGGCAGCGGAGGAGTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Sternson Lab recommendations for propagation of AAV-FLEX plasmids: "These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.
Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.
Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed."
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
aav-SYN-FLEX-tdNfsB(F124W)-mCherry (eNTR) was a gift from Luke Lavis (Addgene plasmid # 113763 ; http://n2t.net/addgene:113763 ; RRID:Addgene_113763) -
For your References section:
Cell-Specific Chemical Delivery Using a Selective Nitroreductase-Nitroaryl Pair. Gruber TD, Krishnamurthy C, Grimm JB, Tadross MR, Wysocki LM, Gartner ZJ, Lavis LD. ACS Chem Biol. 2018 Aug 29. doi: 10.1021/acschembio.8b00524. 10.1021/acschembio.8b00524 PubMed 30111097