aav-CAG-FLEX-tdNfsB(F124W)-mCherry (eNTR)
(Plasmid #113762)

• Purpose: AAV-mediated conditional expression of bacterial tdNfsB-mCherry (eNTR) under the CAG promoter
• Depositing Lab: Luke Lavis
• Publication: Gruber et al ACS Chem Biol. 2018 Aug 29. doi: 10.1021/acschembio.8b00524.

Backbone

• Vector backbone: AAV2
• Backbone manufacturer: Scott Sternson
• Total vector size (bp): 7172
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Stabl2 or Stabl3, 30C or 37C
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: tdNfsB(F124W)-mCherry
• Alt name: nfsb, eNTR
• Species: E. coli
• Insert Size (bp): 2115
• Mutation: F124W
• Promoter: CAG
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: TTAAAGCAGCGTATCCACAT
• 3′ sequencing primer: GGTTCGGCTTCTGGCGTGTGACC

Resource Information

• Supplemental Documents:
  • 3942_aav-CAG-Flex-tdNfsB(F124W)-mCherry (eNTR).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Sternson Lab recommendations for propagation of AAV-FLEX plasmids: "These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.

Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.

Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed."