aav-SYN-tdNfsB(F124W)-mCherry (eNTR)
(Plasmid #113760)

• Purpose: AAV-mediated expression of bacterial tdNfsB-mCherry (eNTR) under the SYN promoter
• Depositing Lab: Luke Lavis
• Publication: Gruber et al ACS Chem Biol. 2018 Aug 29. doi: 10.1021/acschembio.8b00524.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV2
• Total vector size (bp): 6366
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Stabl2 or Stabl3, 30C or 37C
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: tdNfsB(F124W)-mCherry
• Alt name: nfsb, eNTR
• Species: E. coli
• Insert Size (bp): 2109
• Mutation: F124W
• Promoter: Synapsin
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: cgggcgcgaccatctgc
• 3′ sequencing primer: aaggcattaaagcagcgtatc

Resource Information

• Supplemental Documents:
  • 3385_aav-SYN-tdNfsB(F124W)-mCherry (eNTR).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry