pCDF1-MCS2-EF1-Puro-RGS7-E383K
(Plasmid
#113731)
-
PurposeExpress mutant RGS7- E383K- in mamalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113731 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePCDF1
- Backbone size w/o insert (bp) 6583
- Total vector size (bp) 8014
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRGS7
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1407
-
MutationE383K
-
Entrez GeneRGS7
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer atggcccaggggaataattat
- 3′ sequencing primer acaaggatgacgacgataagtaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDF1-MCS2-EF1-Puro-RGS7-E383K was a gift from Yardena Samuels (Addgene plasmid # 113731 ; http://n2t.net/addgene:113731 ; RRID:Addgene_113731) -
For your References section:
RGS7 is recurrently mutated in melanoma and promotes migration and invasion of human cancer cells. Qutob N, Masuho I, Alon M, Emmanuel R, Cohen I, Di Pizio A, Madore J, Elkahloun A, Ziv T, Levy R, Gartner JJ, Hill VK, Lin JC, Hevroni Y, Greenberg P, Brodezki A, Rosenberg SA, Kosloff M, Hayward NK, Admon A, Niv MY, Scolyer RA, Martemyanov KA, Samuels Y. Sci Rep. 2018 Jan 12;8(1):653. doi: 10.1038/s41598-017-18851-4. 10.1038/s41598-017-18851-4 [pii] PubMed 29330521