pLenti6.2_TagBFP
(Plasmid #113724)

• Purpose: Expresses the fluorescent protein TagBFP in a lentiviral backbone
• Depositing Lab: Vanessa LaPointe
• Publication: Fluorescent protein expressing plasmids suitable for lentiviral approaches (unpublished)

Backbone

• Vector backbone: pLenti6.2
• Backbone size w/o insert (bp): 7895
• Total vector size (bp): 8594
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TagBFP
• Alt name: BFP
• Species: Synthetic
• Insert Size (bp): 699
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pLenti6.2-tagBFP.gb
• A portion of this plasmid was derived from a plasmid made by: The pLenti6.2 backbone was isolated from the vector #17448 bought from Addgene. In addition a few additional RE sites were introduced at the 5` end of the ORF generating a small multiple cloning site was inserted that can be used to create fusion proteins.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry