Skip to main content
Addgene

pJEP325-pAAV-FullH1TO-SaCa9sgRNAi(CREB)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
(Plasmid #113702)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113702 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV
  • Backbone manufacturer
    Alligent Technologies
  • Total vector size (bp) 6299
  • Vector type
    Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SaCas9 gRNA Cassete
  • gRNA/shRNA sequence
    GGAGCAGACAACCAGCAGAG
  • Species
    Synthetic
  • Insert Size (bp)
    76

Gene/Insert 2

  • Gene/Insert name
    GFP
  • gRNA/shRNA sequence
    N/A
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • Tag / Fusion Protein
    • KASH (C terminal on insert)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA from Feng Zhang plasmid #61591.pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA from Jonathan Ploski, plasmid #82702.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The H1TO promoter renders the gRNA inducible via the presence of Doxycycline. See: The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing. de Solis CA, Ho A, Holehonnur R, Ploski JE. Front Mol Neurosci. 2016 Aug 18;9:70. doi: 10.3389/fnmol.2016.00070. eCollection 2016. 10.3389/fnmol.2016.00070 PubMed 27587996

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJEP325-pAAV-FullH1TO-SaCa9sgRNAi(CREB)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA was a gift from Jonathan Ploski (Addgene plasmid # 113702 ; http://n2t.net/addgene:113702 ; RRID:Addgene_113702)
  • For your References section:

    The Development of an AAV-Based CRISPR SaCas9 Genome Editing System That Can Be Delivered to Neurons in vivo and Regulated via Doxycycline and Cre-Recombinase. Kumar N, Stanford W, de Solis C, Aradhana, Abraham ND, Dao TJ, Thaseen S, Sairavi A, Gonzalez CU, Ploski JE. Front Mol Neurosci. 2018 Nov 13;11:413. doi: 10.3389/fnmol.2018.00413. eCollection 2018. 10.3389/fnmol.2018.00413 PubMed 30483052