pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pA
(Plasmid #113697)

• Purpose: U6 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB, followed by an EFS driven GFP-KASH in a separate reading frame.
• Depositing Lab: Jonathan Ploski
• Publication: Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413. doi: 10.3389/fnmol.2018.00413. eCollection 2018.

Backbone

• Vector backbone: AAV
• Backbone manufacturer: Alligent Technologies
• Total vector size (bp): 5079
• Vector type: AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: SaCas9 gRNA Cassete
• gRNA/shRNA sequence: GGAGCAGACAACCAGCAGAG
• Species: Synthetic
• Insert Size (bp): 76

Gene/Insert 2

• Gene/Insert name: GFP
• gRNA/shRNA sequence: N/A
• Species: Synthetic
• Insert Size (bp): 717
• Tag / Fusion Protein:
  • KASH (C terminal on insert)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA from Feng Zhang plasmid #61591

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry