pJEP319-pAAV-U6SaCas9gRNA(emx1sg2)-EFS-GFP-KASH-pA
(Plasmid
#113696)
-
PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113696 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV
-
Backbone manufacturerAlligent Technologies
- Total vector size (bp) 5080
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSaCas9 gRNA Cassete
-
gRNA/shRNA sequenceTGGCCAGGCTTTGGGGAGGCC;
-
SpeciesSynthetic
-
Insert Size (bp)76
Gene/Insert 2
-
Gene/Insert nameGFP
-
gRNA/shRNA sequenceN/A
-
SpeciesSynthetic
-
Insert Size (bp)717
-
Tag
/ Fusion Protein
- KASH (C terminal on insert)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA from Feng Zhang plasmid #61591
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEP319-pAAV-U6SaCas9gRNA(emx1sg2)-EFS-GFP-KASH-pA was a gift from Jonathan Ploski (Addgene plasmid # 113696 ; http://n2t.net/addgene:113696 ; RRID:Addgene_113696) -
For your References section:
The Development of an AAV-Based CRISPR SaCas9 Genome Editing System That Can Be Delivered to Neurons in vivo and Regulated via Doxycycline and Cre-Recombinase. Kumar N, Stanford W, de Solis C, Aradhana, Abraham ND, Dao TJ, Thaseen S, Sairavi A, Gonzalez CU, Ploski JE. Front Mol Neurosci. 2018 Nov 13;11:413. doi: 10.3389/fnmol.2018.00413. eCollection 2018. 10.3389/fnmol.2018.00413 PubMed 30483052