Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDB328
(Plasmid #113672)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113672 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET29b
  • Backbone manufacturer
    Novagen
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ulp1_R4
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    714
  • Mutation
    contains solubility enhancing mutations
  • GenBank ID
  • Promoter T7
  • Tags / Fusion Proteins
    • 6-His (N terminal on insert)
    • 6-His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDB328 was a gift from Christopher Bahl (Addgene plasmid # 113672 ; http://n2t.net/addgene:113672 ; RRID:Addgene_113672)
  • For your References section:

    Discovery and engineering of enhanced SUMO protease enzymes. Lau YK, Baytshtok V, Howard TA, Fiala BM, Johnson JM, Carter LP, Baker D, Lima CD, Bahl CD. J Biol Chem. 2018 Aug 24;293(34):13224-13233. doi: 10.1074/jbc.RA118.004146. Epub 2018 Jul 5. 10.1074/jbc.RA118.004146 PubMed 29976752