-
Purposeexpresses Ulp1_R3 in Escherichia coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113671 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET29b
-
Backbone manufacturerNovagen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUlp1_R3
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)714
-
Mutationcontains solubility enhancing mutations
-
GenBank ID
- Promoter T7
-
Tags
/ Fusion Proteins
- 6-His (N terminal on insert)
- 6-His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDB327 was a gift from Christopher Bahl (Addgene plasmid # 113671 ; http://n2t.net/addgene:113671 ; RRID:Addgene_113671) -
For your References section:
Discovery and engineering of enhanced SUMO protease enzymes. Lau YK, Baytshtok V, Howard TA, Fiala BM, Johnson JM, Carter LP, Baker D, Lima CD, Bahl CD. J Biol Chem. 2018 Aug 24;293(34):13224-13233. doi: 10.1074/jbc.RA118.004146. Epub 2018 Jul 5. 10.1074/jbc.RA118.004146 PubMed 29976752