pR BirA
(Plasmid #113640)

• Purpose: Insect cell expression vector for BirA Biotin Ligase
• Depositing Lab: James Moon
• Publication: Moon et al Methods Mol Biol. 2018;1799:165-181. doi: 10.1007/978-1-4939-7896-0_14.

Backbone

• Vector backbone: pRMHa-3
• Backbone size w/o insert (bp): 3830
• Total vector size (bp): 4802
• Modifications to backbone: point mutation at 1796 to ablate second SpeI restriction site
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BirA Biotin Ligase
• Insert Size (bp): 972
• Entrez Gene: birA (a.k.a. b3973, ECK3965, bioR, dhbB)
• Promoter: Metallothionein

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TGTGCAAAAGAGGTGAATCG
• 3′ sequencing primer: CTGCCGCTCCCATTTATCTAT

Resource Information

• Supplemental Documents:
  • pR BirA.gb
• A portion of this plasmid was derived from a plasmid made by: William Kwok, Benaroya Research Institute, Seattle, WA.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This gene encodes a biotin ligase that mediates in vivo biotinylation of BirA signal sequences on recombinant proteins co-expressed in the same cells.