Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pR I-Ab beta Derp1-117
(Plasmid #113639)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113639 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRMHa-3
  • Backbone size w/o insert (bp) 3818
  • Total vector size (bp) 4712
  • Modifications to backbone
    point mutation at 1706 to ablate second SpeI restriction site
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    I-Ab beta Derp1-117
  • Alt name
    H-2 I-Ab beta
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    882
  • Mutation
    transmembrane and cytoplasmic domains truncated
  • Entrez Gene
    H2-Ab1 (a.k.a. AI845868, Abe, Abeta, H-2A, H-2Ab, H2-A, H2-Ab, H2-Ab_, I, I-A<, I-Ab, I-Abeta, IAb, Ia, Ia-2, Ia2, Rmc, Rmcs1)
  • Promoter Metallothionein
  • Tags / Fusion Proteins
    • fused to Der p 1 (117-127) peptide via Gly-Ser linker (inserted downstream of signal peptide) (N terminal on insert)
    • fused to Fos-Jun basic leucine zipper motif via Gly-Ser linker (C terminal on insert)
    • 6x His tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TGTGCAAAAGAGGTGAATCG
  • 3′ sequencing primer CTGCCGCTCCCATTTATCTAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This construct, when co-expressed with the corresponding alpha chain construct in Drosophila S2 cells and induced with copper sulfate, results in secreted expression of soluble peptide:MHCII complexes. The antigenic peptide sequence (residues 117-127 of Der p 1 allergen) is encoded as a fusion to the N-terminus of I-Ab beta, connected via a Gly-Ser linker. This fusion is encoded just downstream of the signal peptide, which should be cleaved during post-translational processing. Alternative antigenic peptides can be cloned in place of Der p 1 117-127 by exploiting the XmaI and SpeI restriction sites flanking this sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pR I-Ab beta Derp1-117 was a gift from James Moon (Addgene plasmid # 113639 ; http://n2t.net/addgene:113639 ; RRID:Addgene_113639)
  • For your References section:

    Generation of Allergen-Specific Tetramers for a Murine Model of Airway Inflammation. Moon JJ, Pepper M. Methods Mol Biol. 2018;1799:165-181. doi: 10.1007/978-1-4939-7896-0_14. 10.1007/978-1-4939-7896-0_14 PubMed 29956152