pR I-Ab alpha BirA
(Plasmid #113638)

• Purpose: Insect cell expression vector for I-Ab alpha chain fused to BirA biotinylation site
• Depositing Lab: James Moon
• Publication: Moon et al Methods Mol Biol. 2018;1799:165-181. doi: 10.1007/978-1-4939-7896-0_14.

Backbone

• Vector backbone: pRMHa-3
• Backbone size w/o insert (bp): 3808
• Total vector size (bp): 4670
• Modifications to backbone: point mutation at 1664 to ablate second SpeI restriction site
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: I-Ab alpha BirA
• Alt name: H-2 I-Ab alpha
• Species: M. musculus (mouse)
• Insert Size (bp): 843
• Mutation: transmembrane and cytoplasmic domains truncated
• Entrez Gene: H2-Ab1 (a.k.a. AI845868, Abe, Abeta, H-2A, H-2Ab, H2-A, H2-Ab, H2-Ab_, I, I-A<, I-Ab, I-Abeta, IAb, Ia, Ia-2, Ia2, Rmc, Rmcs1)
• Promoter: Metallothionein
• Tags / Fusion Proteins:
  • fused to Fos-Jun acidic leucine zipper motif (C terminal on insert)
  • BirA biotinylation signal site (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SbfI (not destroyed)
• 5′ sequencing primer: TGTGCAAAAGAGGTGAATCG
• 3′ sequencing primer: CTGCCGCTCCCATTTATCTAT

Resource Information

• Supplemental Documents:
  • pR I-Ab alpha BirA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct, when co-expressed with the corresponding beta chain construct in Drosophila S2 cells and induced with copper sulfate, results in secreted expression of soluble peptide:MHCII complexes.