Addgene: pR I-Ab alpha BirA Skip to main content
Addgene

pR I-Ab alpha BirA
(Plasmid #113638)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113638 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRMHa-3
  • Backbone size w/o insert (bp) 3808
  • Total vector size (bp) 4670
  • Modifications to backbone
    point mutation at 1664 to ablate second SpeI restriction site
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    I-Ab alpha BirA
  • Alt name
    H-2 I-Ab alpha
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    843
  • Mutation
    transmembrane and cytoplasmic domains truncated
  • Entrez Gene
    H2-Ab1 (a.k.a. AI845868, Abe, Abeta, H-2A, H-2Ab, H2-A, H2-Ab, H2-Ab_, I, I-A<, I-Ab, I-Abeta, IAb, Ia, Ia-2, Ia2, Rmc, Rmcs1)
  • Promoter Metallothionein
  • Tags / Fusion Proteins
    • fused to Fos-Jun acidic leucine zipper motif (C terminal on insert)
    • BirA biotinylation signal site (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SbfI (not destroyed)
  • 5′ sequencing primer TGTGCAAAAGAGGTGAATCG
  • 3′ sequencing primer CTGCCGCTCCCATTTATCTAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This construct, when co-expressed with the corresponding beta chain construct in Drosophila S2 cells and induced with copper sulfate, results in secreted expression of soluble peptide:MHCII complexes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pR I-Ab alpha BirA was a gift from James Moon (Addgene plasmid # 113638 ; http://n2t.net/addgene:113638 ; RRID:Addgene_113638)
  • For your References section:

    Generation of Allergen-Specific Tetramers for a Murine Model of Airway Inflammation. Moon JJ, Pepper M. Methods Mol Biol. 2018;1799:165-181. doi: 10.1007/978-1-4939-7896-0_14. 10.1007/978-1-4939-7896-0_14 PubMed 29956152