pDAI-SceI-SacB
(Plasmid
#113635)
-
PurposeBroad host range replicative plasmid expressing the I-SceI homing endonuclease and the counterselectable marker SacB
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDAI-SceI
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesacB
-
MutationPlease see Depositor Comments
- Promoter sacB promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GCCTTCT TGACGAGTTCTTCTG
- 3′ sequencing primer TCGAGCAAGCTGCAGTTATTTGTTAAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS found K43E and T318P within the SacB translation compared to the best match NCBI reference sequence (ACF93714.1). The depositing laboratory confirms that these mutations should not adversely affect plasmid function
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDAI-SceI-SacB was a gift from Miguel Valvano (Addgene plasmid # 113635 ; http://n2t.net/addgene:113635 ; RRID:Addgene_113635) -
For your References section:
A markerless deletion method for genetic manipulation of Burkholderia cenocepacia and other multidrug-resistant gram-negative bacteria. Aubert DF, Hamad MA, Valvano MA. Methods Mol Biol. 2014;1197:311-27. doi: 10.1007/978-1-4939-1261-2_18. 10.1007/978-1-4939-1261-2_18 PubMed 25172289