CH192
(Plasmid
#113607)
-
PurposeCH192: PIq:luxR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113607 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepsc101
- Backbone size w/o insert (bp) 5239
- Total vector size (bp) 5993
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePIq:luxR
- Promoter Iq
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ctcatttctgaagaggacttgttg
- 3′ sequencing primer gacagcggtgcggactgttgtaactcagaataag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CH192 was a gift from Matthew Bennett (Addgene plasmid # 113607 ; http://n2t.net/addgene:113607 ; RRID:Addgene_113607) -
For your References section:
Tuning the dynamic range of bacterial promoters regulated by ligand-inducible transcription factors. Chen Y, Ho JML, Shis DL, Gupta C, Long J, Wagner DS, Ott W, Josic K, Bennett MR. Nat Commun. 2018 Jan 4;9(1):64. doi: 10.1038/s41467-017-02473-5. 10.1038/s41467-017-02473-5 PubMed 29302024