PE_6: Para_tet_bD
(Plasmid
#113601)
-
PurposePE_6: Para_tet_bD
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113601 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmb1, +ROP
- Backbone size w/o insert (bp) 3886
- Total vector size (bp) 3971
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHybrid Promoter : Para_tet_bD
- Promoter Hybrid Promoter : Para_tet_bD
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CATTTCTGAAGAGGACTTGTTGCG
- 3′ sequencing primer CTTCACCCTCGCCACGCACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PE_6: Para_tet_bD was a gift from Matthew Bennett (Addgene plasmid # 113601 ; http://n2t.net/addgene:113601 ; RRID:Addgene_113601) -
For your References section:
Tuning the dynamic range of bacterial promoters regulated by ligand-inducible transcription factors. Chen Y, Ho JML, Shis DL, Gupta C, Long J, Wagner DS, Ott W, Josic K, Bennett MR. Nat Commun. 2018 Jan 4;9(1):64. doi: 10.1038/s41467-017-02473-5. 10.1038/s41467-017-02473-5 PubMed 29302024