Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXPR_053
(Plasmid #113591)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113591 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLX_TRC931
  • Backbone manufacturer
    Broad Institute
  • Backbone size w/o insert (bp) 5180
  • Total vector size (bp) 7664
  • Modifications to backbone
    (1) Introduction of sgRNA cloning cassette (2) Removal of LacI-2A sequence (3) Replacement of GFP with Vex (4) Mutation of additional BsmBI cloning sites (outside sgRNA cloning cassette)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Vex fluorescence

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    NA
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA cloning site
  • gRNA/shRNA sequence
    NA
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GTGAATAGAGTTAGGCAGGGATATTCACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_053 was a gift from Arlene Sharpe (Addgene plasmid # 113591 ; http://n2t.net/addgene:113591 ; RRID:Addgene_113591)
  • For your References section:

    A CRISPR-Cas9 delivery system for in vivo screening of genes in the immune system. LaFleur MW, Nguyen TH, Coxe MA, Yates KB, Trombley JD, Weiss SA, Brown FD, Gillis JE, Coxe DJ, Doench JG, Haining WN, Sharpe AH. Nat Commun. 2019 Apr 10;10(1):1668. doi: 10.1038/s41467-019-09656-2. 10.1038/s41467-019-09656-2 PubMed 30971695