Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSUPER.retro.puro-shMePCE
(Plasmid #113536)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113536 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSUPER.retro.puro
  • Backbone manufacturer
    OligoEngine
  • Backbone size w/o insert (bp) 6349
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shMePCE
  • gRNA/shRNA sequence
    AAGCCAGAGCAGTTCAGTTCCT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    22
  • Entrez Gene
    MEPCE (a.k.a. BCDIN3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (destroyed during cloning)
  • 3′ cloning site Hind III (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSUPER.retro.puro-shMePCE was a gift from Blerta Xhemalce (Addgene plasmid # 113536 ; http://n2t.net/addgene:113536 ; RRID:Addgene_113536)
  • For your References section:

    Crosstalk between the RNA Methylation and Histone-Binding Activities of MePCE Regulates P-TEFb Activation on Chromatin. Shelton SB, Shah NM, Abell NS, Devanathan SK, Mercado M, Xhemalce B. Cell Rep. 2018 Feb 6;22(6):1374-1383. doi: 10.1016/j.celrep.2018.01.028. 10.1016/j.celrep.2018.01.028 PubMed 29425494