pcDNA3.1 NL-BCL2L1
(Plasmid #113458)

• Purpose: NanoLuc-BCL2L1 expression vector (positive control together with pcDNA3.1 PA-mCit-BAD)
• Depositing Lab: Erich Wanker
• Publication: Trepte et al Mol Syst Biol. 2018 Jul 11;14(7):e8071. doi: 10.15252/msb.20178071.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 6658
• Vector type: Mammalian Expression, Luciferase
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BCL2 like 1
• Species: H. sapiens (human)
• Insert Size (bp): 742
• GenBank ID: CCDS13189.1
• Entrez Gene: BCL2L1 (a.k.a. BCL-XL/S, BCL2L, BCLX, Bcl-X, PPP1R52)
• Promoter: CMV
• Tag / Fusion Protein:
  • cmyc-NanoLuc (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GAACGGCAACAAAATTATCGAC
• 3′ sequencing primer: TAGAAGGCACAGTCGAGGCT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry