Skip to main content
Addgene

pLenti PA-mCit
(Plasmid #113451)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113451 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    FUGW
  • Backbone manufacturer
    FUGW was a gift from David Baltimore (Addgene plasmid # 14883)
  • Total vector size (bp) 10311
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ProteinA-mCitrine
  • Insert Size (bp)
    1071
  • Promoter hUBbC

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tgaagctccggttttgaact
  • 3′ sequencing primer ggcattaaagcagcgtatcc
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Viral Core Facility (VCF) of the Charité – Universitätsmedizin Berlin

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti PA-mCit was a gift from Erich Wanker (Addgene plasmid # 113451 ; http://n2t.net/addgene:113451 ; RRID:Addgene_113451)

  • For your References section:

    LuTHy: a double-readout bioluminescence-based two-hybrid technology for quantitative mapping of protein-protein interactions in mammalian cells. Trepte P, Kruse S, Kostova S, Hoffmann S, Buntru A, Tempelmeier A, Secker C, Diez L, Schulz A, Klockmeier K, Zenkner M, Golusik S, Rau K, Schnoegl S, Garner CC, Wanker EE. Mol Syst Biol. 2018 Jul 11;14(7):e8071. doi: 10.15252/msb.20178071. 10.15252/msb.20178071 PubMed 29997244
Related items:
Commonly requested with: