Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEJS593-pCSDest2-AcrIIC5Smu-BFPv2-IRES
(Plasmid #113439)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113439 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCSDest2
  • Total vector size (bp) 7336
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Type II-C anti-CRISPR
  • Species
    Simonsiella muelleri
  • Insert Size (bp)
    393
  • Promoter CMV

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    mTagBFP2
  • Species
    Synthetic
  • Insert Size (bp)
    711
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEJS593-pCSDest2-AcrIIC5Smu-BFPv2-IRES was a gift from Erik Sontheimer (Addgene plasmid # 113439 ; http://n2t.net/addgene:113439 ; RRID:Addgene_113439)
  • For your References section:

    Potent Cas9 Inhibition in Bacterial and Human Cells by AcrIIC4 and AcrIIC5 Anti-CRISPR Proteins. Lee J, Mir A, Edraki A, Garcia B, Amrani N, Lou HE, Gainetdinov I, Pawluk A, Ibraheim R, Gao XD, Liu P, Davidson AR, Maxwell KL, Sontheimer EJ. MBio. 2018 Dec 4;9(6). pii: mBio.02321-18. doi: 10.1128/mBio.02321-18. 10.1128/mBio.02321-18 PubMed 30514786