-
PurposeExpresses Expresses 10xHis-MBP fused to AaCas12b
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113433 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMBP
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAaCas12b
-
Insert Size (bp)3390
- Promoter T7
-
Tag
/ Fusion Protein
- MBP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATGAAGCCCTGAAAGACGCGCAG
- 3′ sequencing primer CTA GTT ATT GCT CAG CGG T (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMBP-AaCas12b was a gift from Jennifer Doudna (Addgene plasmid # 113433 ; http://n2t.net/addgene:113433 ; RRID:Addgene_113433) -
For your References section:
CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Chen JS, Ma E, Harrington LB, Da Costa M, Tian X, Palefsky JM, Doudna JA. Science. 2018 Apr 27;360(6387):436-439. doi: 10.1126/science.aar6245. Epub 2018 Feb 15. 10.1126/science.aar6245 PubMed 29449511