pGC4785
(Plasmid
#113409)
-
PurposeTranslation reporter with inducible translation coupling (low native GFP expression, high under coupling)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGC4750
- Backbone size w/o insert (bp) 5222
- Total vector size (bp) 5333
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name359_31121113_2
-
Insert Size (bp)111
-
Tag
/ Fusion Protein
- fused to codon deptimized sfGFP with Flexible linker and TEV cleavage site (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site kpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CATGCACATAAGGAGGTACCATAATG
- 3′ sequencing primer ACCCGCCCGATCCACCGGATCCACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGC4785 was a gift from Adam Arkin & Guillaume Cambray (Addgene plasmid # 113409 ; http://n2t.net/addgene:113409 ; RRID:Addgene_113409) -
For your References section:
Evaluation of 244,000 synthetic sequences reveals design principles to optimize translation in Escherichia coli. Cambray G, Guimaraes JC, Arkin AP. Nat Biotechnol. 2018 Nov;36(10):1005-1015. doi: 10.1038/nbt.4238. Epub 2018 Sep 24. 10.1038/nbt.4238 PubMed 30247489