pLexA::Ras
(Plasmid
#11340)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11340 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLexA
-
Backbone manufacturersee pLexA map in "author's map"
- Backbone size w/o insert (bp) 5700
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRas1
-
Alt nameRas-1
-
SpeciesS. pombe (fission yeast)
-
Insert Size (bp)660
-
Entrez Generas1 (a.k.a. SPAC17H9.09c, ste5)
-
Tag
/ Fusion Protein
- LexA DNA binding domain (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
cDNA of fission yeast S. pombe Ras1 gene (oncogene) cloned into the yeast two-hybrid DNA-binding domain vector pLexA (ref., Chang et al., 2004, Cell, 79:131-141). See "author's map" for picture of empty pLexA vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLexA::Ras was a gift from Michael Wigler (Addgene plasmid # 11340 ; http://n2t.net/addgene:11340 ; RRID:Addgene_11340) -
For your References section:
Cooperative interaction of S. pombe proteins required for mating and morphogenesis. Chang EC, Barr M, Wang Y, Jung V, Xu HP, Wigler MH. Cell. 1994 Oct 7. 79(1):131-41. 10.1016/0092-8674(94)90406-5 PubMed 7923372
Map uploaded by the depositor.
