Skip to main content
Addgene

pJF104B
(Plasmid #113324)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113324 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    p15A vector
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    dCas9 and MCP-SoxS_R93A
  • Mutation
    R93A

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACGCATTGATTTGAGTCAGC
  • 3′ sequencing primer tcgtaagccatttccgctcg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid contains a G nucleotide deletion in the BBa_B1002 terminator sequence, which is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJF104B was a gift from Jesse Zalatan (Addgene plasmid # 113324 ; http://n2t.net/addgene:113324 ; RRID:Addgene_113324)

  • For your References section:

    Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria. Dong C, Fontana J, Patel A, Carothers JM, Zalatan JG. Nat Commun. 2018 Jun 27;9(1):2489. doi: 10.1038/s41467-018-04901-6. 10.1038/s41467-018-04901-6 PubMed 29950558
Related items:
Commonly requested with: